메인 콘텐츠 바로가기 주메뉴 바로가기

최상단으로 이동
검체의 처리 절차
가.
모든 검체는 채취 후 최대한 신속하게 1차 배지에 접종한다.
나.
검체를 접종한 배지는 1차 배지의 종류에 따라 24-48시간 동안 배양한다.
다.
1차 배지에서 증식한 집락이 조사 대상 균종으로 의심되는 경우는 분리하여 순수배양 후 균종 동정을 시행한다.
- 수집 균종에 해당하는 모양의 집락이 2종류 이상인 경우, 가장 많은 숫자를 보이는 집락을 선택하고 동일하게 순수 분리 배양하여 실험한다. 증식 정도가 비슷한 경우에는 대표적인 집락을 각각 선택하고 순수 분리 배양하여 동정을 시행한다.
라.
조사 대상 균종에 해당하는 경우는 항생제 감수성 시험을 시행한다.
마.
항생제 감수성 시험이 완료되면 균주의 특성에 따라 내성유전자 확인 시험을 시행한다.
바.
내성유전자 확인 시험이 종료된 균주의 자료는 임상 자료와 통합하여 지정된 데이터 형식으로 정리하며, 원 균주는 skim milk와 microbank에 장기 보관을 시행한다.
| Figure Ⅲ-1 | One Health 항생제 내성균 조사 연구 대상 균주의 수집 및 분석 절차
검체의 접종
임상 검체의 경우는 병원균의 확인을 위해 정량 배양을 필요로 하는 경우가 있지만 One Health 항생제 내성균 연구 사업의 경우는 주요 세균의 분리 및 확보를 위한 목적이므로 정량 또는 반정량 배양의 개념을 적용하지 않는다.
배지 접종의 원칙
가급적 빠른 시간 내에, 집락이 분리될 수 있도록 접종
1) 배지에 접종하기 전에 검체를 육안으로 확인하여, 용기에 파손이 있거나, 뚜껑이 열려 검체가 오염되었는지를 확인한다. 오염된 검체는 접종하지 않는 것을 원칙으로 한다.
2) 수송배지 내 면봉을 이용하여 배지의 1/4분면에 접종한다. 접종한 면봉은 수송배지에 다시 넣지 않고 폐기한다.
3) 멸균한 백금이 (Loop)를 사용하여 첫 번째 구역을 획선하고 순차적으로 2/4 – 4/4 분면으로 검체를 접종한다.
4) 검체에 적은 숫자의 세균이 있는 경우는 백금이를 사용하지 않고 면봉으로 1/4 분면에서 4/4 분면까지 접종한다.
5) 증균이 필요한 경우는 면봉이 오염되지 않도록 주의하며, 증균용 액체 배지에 접종하여 하룻밤 배양한다. 배양한 액체배지를 10 μL 채취하여 (마이크로 파이펫 또는 1/100 백금이 사용), 1차 배지의 1/4 분면에 접종하고, 백금이를 사용하여 순차적으로 2/4 – 4/4분면으로 접종을 한다.
6) 접종한 배지는 37 °C, ambient air 상태로 종류에 따라 정해진 시간 동안 배양한다.
Enrichment broth를 사용한 1차 증균 배양
다음의 세균 또는 일부 환경 검체는 분리율을 높이기 위해 1차 증균 배지의 사용을 고려한다.
가.
환경검체
1) Swab sample은 전처리한 시료 200㎕를 10㎖ Buffered Peptone Water (BPW)에 가한 후 36±1℃에서 18~24시간 배양한다.
2) 시료 25g(㎖)에 225㎖의 BPW(Buffered Peptone Water)를 첨가하여 36±1℃에서 18~24시간 배양한다.
3) 환경 검체의 CRE (CPE) 분리: Trypticase soy broth (TSB) 5mL에 검체를 접종하고, 10㎍ ertapenem (ETP) 디스크를 넣고 35℃에서 하룻밤 배양한다.
나.
Salmonella 균종 및 Shigella 균종
Selenite broth에 접종하고 35-37°C에서 18-24시간 배양한 후에 MAC, Salmonella-Shigella(SS) 배지 또는 CHROMagar 등의 선택 배지에 접종한다.
선별배지의 종류 및 집락 특성
증균한 검체나 증균하지 않아도 되는 검체는 다음 종류에 따라 선별배지 (발색배지)를 시행한다.
가.
CHROMagar orientation

대상균종

집락 모양

배양 조건

S. aureus

Golden, opaque, small

37℃, 24-48시간

(24시간 배양 후에 의심 집락이

없으면 추가 24시간 배양)

S. epidermidis

S. pseudintermedius

Cream, pinpoint

E. faecalis

E. faecium

Turquoise blue

E. coli

Dark pink to reddish

K. pneumoniae

Citrobacter spp.

Enterobacter spp.

Metallic blue (+/- reddish halo)

P. aeruginosa

Translucent 

(+/- natural pigmentation cream to green)

Acinetobacter spp.

Cream (그림 추가)

 

 

 

나.
CHROMagar Pseudomonas

대상균종

집락 모양

배양 조건

P. aeruginosa

blue-green

37 ℃, 24-48시간

(24시간 배양 후에 의심 집락이

없으면 추가 24시간 배양)

다.
CHROMagar Acinetobacter

대상균종

집락 모양

배양 조건

A. baumannii

Red

37 ℃, 24-48시간

(24시간 배양 후에 의심 집락이

없으면 추가 24시간 배양)

라.
SS

대상균종

집락 모양

배양 조건

Salmonella spp.

Shigella spp.

Colorless or black


37 ℃, 24시간

(24시간 배양 후에 판독이

어려운 경우는 배지를 판독할 수

있을 때까지 냉장 보관)

마.
CHROMagar Salmonella

대상균종

집락 모양

배양 조건

Salmonella spp.

Mauve

37 ℃, 24-48시간

(24시간 배양 후에 의심 집락이

없으면 추가 24시간 배양)

바.
CampyBAP

대상균종

집락 모양

배양 조건

Campylobacter spp.

Gray, flat, irregular

42 ℃, 72시간, microaerophilic

(5% O2, 10% CO2, 85% N2)

사.
CHROMagar Campylobacter

대상균종

집락 모양

배양 조건

Campylobacter spp.

Red

42 ℃, 48시간, microaerophilic

(5% O2, 10% CO2, 85% N2)

균종별 동정 방법
가.
동정 원칙
1) 균종 동정은 순수 분리 배양된 1개의 집락을 사용하는 것을 원칙으로 한다. 집락을 선택할 때 배지의 바닥을 긁지 않도록 주의한다.
2) 균종 동정 방법은 MALDI-TOF 질량분석기를 사용한다.
- S. pseudintermediusCampylobacter 균종은 추가적으로 PCR을 사용한다.
- Acinetobacter 균종은 추가적으로 PCR 및 염기서열 분석을 시행한다.
- Shigella 균종의 경우는 항혈청 및 생화학적 방법 (자동화 장비 사용 가능)을 사용하여 동정한다.
- Shigella 균종 외에 부득이하게 생화학적 자동화장비 또는 기타 방법을 사용하는 경우는 먼저 주관 부서와 협의한다.
3) 요한 경우는 16S rRNA 염기서열분석을 시행하여 확인하며, 염기서열 확인을 위해서는 EZ BioCloud 데이터베이스를 권장한다(Formerly EZtaxon, https://www.ezbiocloud.net/identify)
4) 본 지침에서 제안한 방법으로 정확하게 동정이 되지 않는 경우는 시험관리센터로 연락하여 균주를 발송하고, 그 결과를 확인한다.
나.
균종 동정
* 그람양성 균주
혈액한천배지 (S. aureus, S. epidermidis, S. pseudintermedius, E. faecalisE. faecium) 또는 MAC 한천배지 (E. coli, K. pneumoniae, Citrobacter spp., Enterobacter spp., P. aeruginosa, Acinetobacter spp., Salmonella spp. 및 Shigella spp.) 및 캠필로박터 혈액한천배지 (Campy BAP, Campylobacter 균종)에 계대 배양을 하여, 동정 준비를 한다.
1) S. aureus, S. epidermidis, E. faecalis, E. faecium, E. coli, K. pneumoniae, Citrobacter spp. Enterobacter spp. P. aeruginosa
이들 균종은 MALDI-TOF 질량분석기를 사용하여 시험하고, score가 ≥2.0이면 동정을 완료하고, < 2.0이면 16S rRNA 염기서열 분석을 통해 균종을 확인한다. MALDI-TOF 질량분석기를 사용할 수 없는 경우는 주관부서와 협의한다.
2) S. pseudintermedius
S. pseudintermedius는 MALDI-TOF 질량분석기에서 S. intermedius 또는 S. pseudintermedius로 확인된 균주를 대상으로 균종 동정을 위한 PCR을 시행한다.
가) Multiplex nuc gene PCR (Sasaki T. et al. JCM 2010)
나) Primer set

Species 

Target gene

Primer 

name

Primer sequence (5-3)

Amplicon 

size

S. aureus

nuc

gene

au-F3

TCGCTTGCTATGATTGTGG

359 bp

au-nucR

GCCAATGTTCTACCATAGC

S. intermedius

In-F

CATGTCATATTATTGCGAATGA

430 bp

In-R3

AGGACCATCACCATTGACATATTGAAACC

S. pseudintermedius

pse-F2

TRGGCAGTAGGATTCGTTAA

926 bp

pse-R5

CTTTTGTGCTYCMTTTTGG

PCR 조건: 95℃ 2 min + 30X (95℃ 30sec + 56℃ 30sec + 72℃ 60 sec) + 72℃ 10 min

3) Acinetobacter 균종

Acinetobacter 균종은 MALDI-TOF 질량분석기를 사용하여 균종을 확인한 후에 OXA-51 species-specific PCR로 A. baumannii를 확인한다. PCR 음성인 균주는 rpoB sequencing을 시행하여 정확한 균종을 확인한다. 환경에는 다양한 Acinetobacter 균종이 존재하므로, 사람에서 분리빈도가 높은 A. baumannii, A. nosocomialis 및 A. pittii 의 3개 균종만을 대상으로 시험하고 수집한다.
| Figure Ⅲ-2 | Acinetobacter 균종의 동정 절차
가) OXA-51 species-specific PCR

Gene

Primer name

Primer sequence

Amplicon size

blaOXA-51

OXA-51 F

GAACATTAAAACACTCTTACTTAT

825 

OXA-51 R

TTAGAACAATTAGGTATTTTATAG

PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + 56℃ 20sec + 72℃ 40 sec) + 72℃ 7 min

나) rpoB gene sequencing

Gene

Primer name

Primer sequence

Amplicon size

rpoB

ABA_rpoB-F

GTGATAARATGGCBGGTCGT

560

ABA_rpoB-R

CGBGCRTGCATYTTGTCRT

PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + 56℃ 20sec + 72℃ 40 sec) + 72℃ 7 min

4) Salmonella 균종

Salmonella는 MALDI-TOF 질량분석기를 사용하여 동정하고 항혈청을 이용하며 확인한다. Score가 ≥2.0이면 동정을 완료하고, <2.0이면 16S rRNA 염기서열 분석을 통해 균종을 확인한다.
5) Shigella 균종

Shigella는 항혈청을 이용하여 혈청형을 확인하고, 생화학적 자동동정 장비를 사용하여 균종을 확인한다. (MALDI-TOF 질량분석기로는 E. coliShigella 균종이 구별되지 않음)
6) Campylobacter 균종

Campylobacter는 의심 집락을 선택하여 3가지 시험으로 예비 동정을 시행한다. C. jejuni와 C. coli의 확실한 동정을 위해서는 hipO 유전자와 asp 유전자를 PCR로 확인한다.
가) 균속 확인을 위한 간이 시험법
(가) 현적표본 검사: 빠른 운동성 확인
① Cover slide에 싸인펜 또는 바세린으로 사각형 또는 원 모양의 벽을 얇게 만든다
② 벽 안에 한 방울의 균액을 떨어뜨리고, depression slide의 오목한 부분 위에 cover slide를 놓는다.
③ 암시야 현미경 (또는 위상차 현미경이나 조명을 줄인 광학 현미경)을 통해 운동성을 가진 curved short rod를 확인한다.
④ Depression slide가 없는 경우는 wet mount preparation을 통해서도 운동성 확인이 가능하다. (Slide 위에 균액 1방울을 떨어뜨리고 cover slide를 덮고, 위상차 현미경 또는 조명을 줄인 광학 현미경을 통해 관찰한다)
(나) Oxidase 양성
① 조그만 filter paper 조각에 시험하고자 하는 집락을 직접 묻히거나 스틱 또는 루프를 사용하여 균을 바른다.
② Kovac 시약을 1방울 떨어트려서 보라색의 색상 변화가 일어나는지 확인한다.
(다) 그람염색에서 구부러진 막대균 확인
Campylobacter 균종이 의심되는 집락을 선택하여 그람 염색을 시행한다.
② 대조염색으로는 safranin 대신에 carbol-fuchsin을 사용한다.
③ 그람음성의 구부러진 막대균을 확인한다.
나) PCR 최종 동정

Species 

Target gene

Primer 

name

Sequence (5-3)

Amplicon 

size

C. jejuni

hipO

HIP400F

GAAGAGGGTTTGGGTGGTG

735 bp

HIP1134R

AGCTAGCTTCGCATAATAACTTG

C. coli

asp

CC18F

GGTATGATTTCTACAAAGCGAG

500 bp

CC519R

ATAAAAGACTATCGTCGCGTG

PCR 조건: 94℃ 1 min + 25X (94℃ 1 min + 66℃ 1 min (hipO)/60℃ 1 min (asp) + 72℃ 1 min) + 72℃ 1 min