메인 콘텐츠 바로가기 주메뉴 바로가기

최상단으로 이동
S. aureus, S. epidermidis S. pseudintermedius
가.
분석 원칙
1) 1차 배지에서 Staphylococcus 균종이 의심되는 집락이 증식하면 MALDI-TOF 질량분석기로 동정을 시행한다.
2) S. aureusS. epidermidis 균종으로 확인된 균주는 cefoxitin 디스크 확산법 결과에 따라 mecA PCR 및 SCCmec typing을 시행한다. Methicillin 내성인 균주가 mecA 음성인 경우는 mecC PCR을 시행한다. Methicillin 내성-mecA 음성-mecC 음성인 경우는 주관부서에 통보한다.
3) MALDI-TOF 질량 분석기에서 S. intermedius S. pseudintermedius로 확인된 균주는 nuc gene PCR을 시행하여 최종 동정을 시행한다. S. pseudintermedius로 확인된 균주는 oxacillin 디스크 확산법의 결과에 따라 mecA PCR 및 SCCmec typing을 시행한다. Methicillin 내성인 균주가 mecA 음성인 경우는 mecC PCR을 시행한다. Methicillin 내성-mecA 음성-mecC 음성인 경우는 주관부서에 통보한다.
4) Staphylococcus 균종은 SCCmec type의 비교를 위해 S. aureus의 SCCmec typing 방법을 사용하는 것을 원칙으로 한다, 하지만 S. epidermidis S. pseudintermedius 에 해당하는 균주의 SCCmec typing이 불가능한 경우는 whole genome sequencing을 통하여 SCCmec type을 확인한다.
나.
내성유전자 확인 PCR

특성

Genes

Primer 

Sequence

Anealing T (℃)

Amplicon

내성 유전자

mecA1

mA1

TGCTATCCACCCTCAAACAGG

59

286

mA2

AACGTTGTAACCACCCCAAGA

mecC2

mecC MFP

GAAAAAAAGGCTTAGAACGCCTC

60

138

mecC MRP

GAAGATCTTTTCCGTTTTCAGC

분자역학

SCCmec3

ccrA1

CAAGCCTTATCAGGTACGAA

56

5: 202 bp

2: 307 bp

4: 406 bp

7: 519 bp

1: 672 bp

8: 802 bp

3: 982 bp

ccrA2

CATTACGTCAACAACCGCAA

ccrA3

CTGAATCATTCAGAAAACAGAC

ccrA4

GTCCTAAAACAGCAACAAATGA

ccrB1

GAGCATTAACTTGCCTGTTG

ccrB2

CCTTCTGTGCTTTGCATTTC

ccrB3

GACCTTCGTTCGCATCTTTT

ccrB4

GGTTACAGTATTCAAGGTCAAT

ccrB6

CTGGTATGTTATTATATCCTAAAG

ccrC1

GCAATGAAACGTCTATTACAAG

ccrC2

CAAACATTGTAACGAGTACTTC

>mecA_univ

CTGCTATCTTTATAAACTTGTTTG

56

A: 1358 bp

B: 1235 bp

C1: 717 bp

C2: 533 bp

E: 979 bp

mecA_E

ACATAACCTAAAAGGTGTACTG

mecR1_B

TCATGTGAAGCTCGATATACTA

ecR1_E

ACCAAACTTTATGATTTAACTGAG

merR1_A

TTCATTATAAAGCACAAAACTTCC

IS431_C2

GTTGAATGATGAACGTTTACAC

IS431_C1

GGGACATACATTAGATATTTGG

1. PCR 조건: 94℃ 2 min + 30X (94℃ 2 min + 57℃ 1 min + 72℃ 2 min) + 72℃ 2 min

2. PCR 조건: 94℃ 15 min + 30X (94℃ 30sec + 59℃ 1 min + 72℃ 1 min) + 72℃ 10 min

3. ccr gene PCR 조건: 95℃ 5 min + 28X (97℃ 10sec + 56℃ 20sec + 72℃ 40 sec) + 72℃ 7 min

4. mec gene PCR 조건: 95℃ 5 min + 28X (97℃ 10sec + 56℃ 20sec + 72℃ 1 min) + 72℃ 7 min

| Figure Ⅴ-1 | Staphylococcus 균종의 분석 흐름도
다.
SCCmec typing 해석
1) SCCmec type은 ccr 유전자의 종류와 mec gene complex의 조합에 따라 SCCmec type이 결정된다.
2) ccr multiplex PCR 결과에 따라 ccr 유전자의 종류를 결정한다.
3) mec gene complex muliplex PCR 결과에 따라 mec gene complex 종류를 결정한다.
4) ccr 유전형과 mec gene 유전형을 조합하여 SCCmec 유전형을 결정한다.

SCCmec type

ccr (bp)

mec gene complex (bp)

I

672

1235

II

307

1358

III

982

1358

IV

307

1235

V

202

533

VI

406

1235

VII

202

717

VIII

406

1358

IX

672

533

X

517

717

XI

802

979

라.
유전자 분석 참조균주

Target genes

참조균주

내성유전자

mecA

SA ROH0001G

SCCmec

SCCmec I

ATCC BAA-44

SCCmec II

SA ROH0028G

SCCmec III

ATCC 33592

SCCmec IV

SA ROH0029G

SCCmec V

ATCC BAA-2094

SCCmec VII

SA ROH0030G

SCCmec XI (mecC)

ATCC BAA-2313

Typing

agr I

SA ROH0004G

agr II

SA ROH0005G

agr III

SA ROH0006G

agr IV

SA ROH0007G

E. faecalisE. faecium
가.
내성유전자 확인 PCR (Vancomycin 디스크 억제대 ≤ 16 mm)

항목

유전자

Primer 

Sequence

Anealing T (℃)

Amplicon

내성 

유전자

vanA1

vanA F

AGCTGTACTCTCGCCGGATA

52

320

vanA R

CCGGCTTAACAAAAACAGGA

vanB1

vanB F

GGCTCAGAAAATGCGATGAT

52

250

vanB R

TGTCAATCAGTGCAGGAAGC

vanM2

vanHM F

CAGCGTGGGGCACAAGTCTGA

58

377

vanHM R

TGCCGTACGCCAACACGTGA

1. PCR 조건: 94℃ 3 min + 30X (94℃ 1 min + 52℃ 30sec + 72℃ 30sec) + 72℃ 10 min

2. PCR 조건: 94℃ 3 min + 30X (94℃ 1 min + 55℃ 30sec + 72℃ 30sec) + 72℃ 10 min

나.
내성유전자 확인 참조균주

Target genes

참조균주

내성유전자

vanA

EM ROH0015G

vanB

ATCC 51575

E. coli, K. pneumoniae, Citrobacter 균종, Enterobacterer 균종,
Salmonella 균종 및 Shigella 균종
가.
특성 분석 원칙
1) E. coliK. pneumoniae
가) 1차 배지에서 의심 집락이 증식하면 MALDI-TOF 질량분석기로 동정을 시행한다.
나) E. coliK. pneumoniae로 확인된 균주는 항생제 감수성 결과에 따라 ESBL 생성 의심 균주, PABL (Plasmid-mediated AmpC β-lactamase) 생성 의심 균주 및 CPE 의심 균주로 분류한다.
다) 의심되는 내성의 양상에 따라 ESBL double disk synergy 검사 및 CarbaNP 또는 mCIM 추가 감수성 시험을 시행하고, 내성 유전자 PCR 및 염기서열분석을 시행한다(시험 균주에 따라 추가 감수성 시험은 생략할 수 있다).
라) BMD로 시행한 colistin 감수성 시험에서 MIC ≥ 4 μg/mL이면 mcr(mobile colistin resistance)에 대한 PCR을 시행한다.
2) Citrobacter 균종 및 Enterobacter 균종
가) 1차 배지에서 의심 집락이 증식하면 MALDI-TOF 질량분석기로 동정을 시행한다.
나) Citrobacter 균종 및 Enterobacter 균종으로 확인된 균주는 항생제 감수성 결과에 따라 ESBL 생성 의심 균주 및 CPE 의심 균주로 분류한다. Citrobacter 균종과 Enterobacter 균종은 유전자에 ampC β-lactamase를 가지고 있으므로 PABL은 시험하지 않는다.
다) 의심되는 내성의 양상에 따라 ESBL double disk synergy 검사 및 carbaNP 또는 mCIM 추가 감수성 시험을 시행하고, 내성 유전자 PCR 및 염기서열분석을 시행한다(시험 균주에 따라 추가 감수성 시험은 생략할 수 있다).
라) BMD로 시행한 colistin 감수성 시험에서 MIC ≥ 4 μg/mL이면 mcr (mobile colistin resistance)에 대한 PCR을 시행한다.
3) Salmonella 균종 및 Shigella 균종
가) 1차 배지에서 의심 집락이 증식하면 항혈청, MALDI-TOF 질량분석기 또는 자동화 장비로 동정을 시행한다.
나) Salmonella 균종 및 Shigella 균종으로 확인된 균주는 항생제 감수성 결과에 따라 ESBL 생성 의심 균주로 분류하고 추가 감수성 시험 (Double disk synergy), ESBL PCR 및 염기서열 분석을 시행한다.
다)Salmonella 균종에서 quinolone 내성이 의심되는 경우는 QRDR (quinolone-resistance determining region)에 대한 염기서열분석을 시행한다.
라) BMD로 시행한 colistin 감수성 시험에서 MIC ≥ 4 μg/mL이면 mcr (mobile colistin resistance)에 대한 PCR을 시행한다.
나.
내성유전자 확인 PCR

항목

Target gene

Primer name

Primer sequence

Anealing T (℃)

Amplicon size (bp)

내성 

유전자

blaOXA-231

OXA-23 F

CTCTTTTTCTTTCTGGTTGTAC

54

776

OXA-23 R

CAGCTGTTTTAATGATTTCATC

 

 

blaOXA-241

OXA-24 F

CTTCCTATATTCAGCATTTCTATT

56

807

OXA-24 R

GATTCCAAGATTTTCTAGCGAC

 

 

blaOXA-581

OXA-58 F

GCTTAAGCATAAGTATTGGGG

55

793

OXA-58 R

CCCAACTTATCTAGCACATC

 

 

blaOXA-481

OXA-48 F

TTGGTGGCATCGATTATCGG

57

744

OXA-48 R

GAGCACTTCTTTTGTGATGGC

 

 

blaOXA-1432

OXA-143 F

CTTCCTATTCTCAGCATTTCTAC

56

820

OXA-143 R

CCCTAAATTATATAATCCCTAAATTC

 

 

blaOXA-2352

OXA-235 F

GAAAACTCTTATTTTGTTGCCTTTA

56

826

OXA-235 R

CCCTTCAGCTTTCGGATAAAG

 

 

blaOXA-511

OXA-51 F

GAACATTAAAACACTCTTACTTAT

56

823

OXA-51 R

TTAGAACAATTAGGTATTTTATAG

 

 

ISAba1-blaOXA-512

ISAba1-OXA-51 F

CCCATTTCCAATTGGTTCTATC

56

570

ISAba1-OXA-51 R

CCATAGCTTTGTTGAGTTTGG

 

 

blaTEM3

TEM F

ATGAGTATTCAACATTTCCGT

59

861

TEM R

TTACCAATGCTTAATCAGTGA

 

 

blaSHV3

SHV F

CCGGGTTATTCTTATTTGTCGCT

61

927

SHV R

TAGCGTTGCCAGTGCTCG

 

 

blaCTX-M-11

CTXM-1 F

ACCGTCACGCTGTTGTTAGG

56

819

CTXM-1 R

GTCGGTGACGATTTTAGCCG

 

 

blaCTX-M-21

CTXM-2 F

AATGTTAACGGTGATGGCGA

56

844

CTXM-2 R

ACCGTGGGTTACGATTTTCG

 

 

blaCTX-M-91

CTXM-9 F

GTGCAACGGATGATGTTCG

56

845

CTXM-9 R

ATGATTCTCGCCGCTGAAG

 

 

blaCTX-M-251

CTXM-25 F

GTAAGGCGGGCGATGTTAAT

56

856

CTXM-25 R

AACCGTCGGTGACAATTCTG

 

 

blaKPC2

KPC F

ATGTCACTGTATCGCCGTCT

56

893

KPC R

TTTTCAGAGCCTTACTGCCC

 

 

blaPER4

PER F

GAATGTCATTATAAAAGCTGTAGT

55

915

PER R

CTTAGGGCAGAAAGCTTTTTC

 

 

blaGES2

GES F

GCGCTTCATTCACGCACTAT

56

753

GES R

GCGTAATCTCTCTCCTGGGC

 

 

blaIMP2

IMP F

TGAGCAATGTATCTGTATTC

56

740

IMP R

TTAGTTGCTTGGTTTTGATG

 

 

blaVIM2

VIM F

TGGTCTACATGACCGCGTCT

56

766

VIM R

CGACTGAGCGATTTGTGTG

 

 

blaNDM-12

NDM-1 F

CAATATTATGCACCCGGTCG

56

726

NDM-1 R

ATCATGCTGGCCTTGGGGAA

 

 

blaCMY-15

MOXM F

CAACAACGACAATCCATCCTG

58

1086

MOXM R

GTTGCGATTGGCCAGCATG

 

 

blaCMY-25

CIT F

TGATGAAAAAATCGTTATGCTCC

56

1097

CIT R

GTTAGGATAGCTTTTGTTTGCC

 

 

blaDHA6

DHA F

GTTATCTGCAACACTGATTTCC

56

1118

DHA R

CACTCAAAATAGCCTGTGCAG

 

 

blaACC6

ACC F

GAACACATTGAAGCTGTTATCC

56

1153

ACC R

CTTATTCCCTTCCAATGAGCTC

 

 

blaACT-16

ACT F

GATGACAAAATCCCTAAGCTGT

56

1098

ACT R

GGGTTCGGATAGCTTTTATTC

 

 

blaFOX6

FOX F

CATTATCCAGCCGATGCTCAA

58

1001

FOX R

TGGCCTCGATGGGATAGTTG

 

 

mcr-17

CLR5-F

CGGTCAGTCCGTTTGTTC

56

309

CLR5-R

CTTGGTCGGTCTGTAGGG

 

 

mcr-1 / -28

mcr-12-281F

CTTATGGCACGGTCTATGA

54

650

mcr-12-930R

CACATTTTCTTGGTATTTGG

 

 

1. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 40sec) + 72℃ 7 min

2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 30sec) + 72℃ 7 min

3. PCR 조건: 94℃ 5 min + 35X (94℃ 30sec + Anealing T(℃) 30sec + 72℃ 30sec) + 72℃ 7 min

4. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 1 min) + 72℃ 7 min

5. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + Anealing T(℃) 30sec + 72℃ 1 min) + 72℃ 7 min

6. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 1 min) + 72℃ 7 min

7. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 56℃ 20sec + 72℃ 20sec) + 72℃ 7 min

8. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 54℃ 20sec + 72℃ 40sec) + 72℃ 7 min

| Figure Ⅴ-2 | E. coli, K. pneumoniae, Citrobacter 균종 및 Enterobacter 균종의 분석 흐름도
| Figure Ⅴ-3 | Salmonella 균종 및 Shigella 균종의 분석 흐름도
다.
내성유전자 확인 참조균주

Target genes

참조균주

보유유전자

내성유전자

CTX-M1

EC ROH0016G

CTX-M15

CTX-M1

EC ROH0031G

CTX-M55

CTX-M1

EC ROH0032G

CTX-M186

CTX-M9

EC ROH0017G

CTX-M14

CTX-M9

EC ROH0033G

CTX-M27

TEM

EC ROH0018G

TEM-1

SHV

KP ROH0019G

SHV-1

IMP

PA ROH0020G

IMP-6

VIM

PA ROH0021G

VIM-2

GES

KP ROH0022G

GES-5

NDM

EC ROH0023G

NDM-1

NDM

EC ROH0034G

NDM-5

KPC

KP ROH0024G

KPC-2

OXA-48

KP ROH0025G

OXA-232

DHA-1

EC ROH0026G

DHA-1

CMY-2

EC ROH0027G

CMY-2

라.
내성 기전 표현형 시험
1) Double disk synergy 시험
① 하룻밤 배양한 시험 대상 균주를 사용하여 0.5 McF 균액을 만들고, 디스크 확산법 검사와 같은 방법으로 MHA에 접종한다.
② 배지의 정중앙에 clavulanic acid 또는 clavulanic acid가 포함된 항생제 디스크를 놓는다.
③ Clavulanic acid 디스크를 중심으로 클로버 모양으로 cetotaxime, ceftazidime 또는 cefepime 디스크를 디스크 가장 자리가 1.5-2 cm 간격이 되도록 놓는다.
④ 35℃±2℃에서 18-24시간 동안 배양한다.
⑤Clavulanic acid와 cefotaxime, ceftazidime 또는 cefepime 디스크 간에 억제대의 증폭이 있으면 양성으로 판정한다.
| Figure Ⅴ-4 | Cefepime과 amoxicillin-clavulanic acid 디스크를 사용한 double disk synergy 시험 결과
파란색 원은 억제대의 변화가 없음을 나타내고 붉은 색 원은 억제대의 증폭이 발생하여 ESBL 양성임을 나타낸다.
2) Carba NP 시험 (Rapiddec Carba NP, bioMerieux, Marcy Eʼtolile, France)
① 2개의 microcentrifuge tube에 라벨을 표기한다(a 및 b).
② 각 tube에 100 μL의 bacterial protein extraction 용액을 각각 넣는다.
③ 하룻밤 배양한 시험 대상 균주를 1 μL 루프 (1/1000 백금이)를 사용하여 각각의 tube에 접종하고 5초간 vortex로 혼합한다.
④ 시험 용액 A와 B를 각각의 라벨이 붙은 tube에 접종한다(상용 시약).
⑤ vortex를 사용하여 tube를 잘 혼합한다.
⑥ 35℃±2℃에서 2시간 동안 배양한다.
⑦ 판독한다 (시약 매뉴얼 참조)
3) Modified carbapenem inactivation method (mCIM)
① 하룻밤 배양한 시험 대상 균주를 1 μL 루프 (1/1000 백금이)를 사용하여 2 mL TSB에 접종한다.
② 10-15초간 vortex를 사용하여 혼합한다.
③ 10 μg meroepenem 디스크를 멸균된 기구 (forcep)를 사용하여 균액 (세균이 접종된 2 mL TSB)에 완전히 잠기도록 넣는다.
④ 35℃±2℃에서 4시간±15분 동안 배양한다.
E. coli ATCC 25922 표준 균주를 사용하여 0.5 McF 탁도의 균액을 준비한다.
⑥ 준비된 E. coli ATCC 25922 균액은 15분 이내에 MHA 한천 배지에 접종하고 3-10분간 배지를 건조시킨다.
⑦ 다)에서 사용한 TSB에서 meropenem 디스크를 무균법으로 꺼내어 바)에서 준비한 배지에 디스크 확산법 검사하는 것처럼 접종한다.
⑧ 35℃±2℃에서 18-24시간 배양한다.
⑨ 15 mm 이하의 억제대가 생기거나 16-18 mm 영역에 집락이 형성되면 carbapenemase 양성으로 판정한다.
P. aeruginosa
가.
내성기전 분석 PCR
Carbapenem에 대해서 중간이거나 내성인 균주 및 BMD로 시행한 감수성 시험에서 MIC ≥ 4 μg/mL

항목

Target gene

Primer name

Primer sequence

Anealing T (℃)

Amplicon size (bp)

내성

유전자

blaPER1

PER F

GAATGTCATTATAAAAGCTGTAGT

55

915

PER R

CTTAGGGCAGAAAGCTTTTTC

 

 

blaGES2

GES F

GCGCTTCATTCACGCACTAT

56

753

GES R

GCGTAATCTCTCTCCTGGGC

 

 

blaIMP2

IMP F

TGAGCAATGTATCTGTATTC

56

740

IMP R

TTAGTTGCTTGGTTTTGATG

 

 

blaVIM2

VIM F

TGGTCTACATGACCGCGTCT

56

766

VIM R

CGACTGAGCGATTTGTGTG

 

 

blaNDM-12

NDM-1 F

CAATATTATGCACCCGGTCG

56

726

NDM-1 R

ATCATGCTGGCCTTGGGGAA

 

 

mcr-13

CLR5-F

CGGTCAGTCCGTTTGTTC

56

309

CLR5-R

CTTGGTCGGTCTGTAGGG

 

 

mcr-1 / -24

mcr-12-281F

CTTATGGCACGGTCTATGA

54

650

mcr-12-930R

CACATTTTCTTGGTATTTGG

 

 

1. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + 55℃ 20sec + 72℃ 1 min) + 72℃ 7 min

2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 30sec) + 72℃ 7 min

3. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 56℃ 20sec + 72℃ 20sec) + 72℃ 7 min

4. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 54℃ 20sec + 72℃ 40sec) + 72℃ 7 min

나.
내성유전자 확인 참조균주

Target genes

참조균주

보유유전자

내성유전자

IMP

PA ROH0020G

IMP-6

VIM

PA ROH0021G

VIM-2

GES

KP ROH0022G

GES-5

NDM

EC ROH0023G

NDM-1

NDM

EC ROH0034G

NDM-5

A. baumannii, A. nosocomialisA. pittii
가.
내성유전자 확인 PCR
Carbapenem에 대해서 중간이거나 내성인 균주 및 BMD로 시행한 감수성 시험에서 MIC ≥ 4 μg/mL일 때 시행

항목

Target gene

Primer name

Primer sequence

Anealing T (℃)

Amplicon size (bp)

내성

유전자

blaOXA-231

OXA-23 F

CTCTTTTTCTTTCTGGTTGTAC

54

776

OXA-23 R

CAGCTGTTTTAATGATTTCATC

 

 

blaOXA-241

OXA-24 F

CTTCCTATATTCAGCATTTCTATT

56

807

OXA-24 R

GATTCCAAGATTTTCTAGCGAC

 

 

blaOXA-581

OXA-58 F

GCTTAAGCATAAGTATTGGGG

55

793

OXA-58 R

CCCAACTTATCTAGCACATC

 

 

blaOXA-481

OXA-48 F

TTGGTGGCATCGATTATCGG

57

744

OXA-48 R

GAGCACTTCTTTTGTGATGGC

 

 

blaOXA-511

OXA-51 F

GAACATTAAAACACTCTTACTTAT

56

823

OXA-51 R

TTAGAACAATTAGGTATTTTATAG

 

 

ISAba1-

blaOXA-512

ISAba1-OXA-51 F

CCCATTTCCAATTGGTTCTATC

56

570

ISAba1-OXA-51 R

CCATAGCTTTGTTGAGTTTGG

 

 

blaIMP2

IMP F

TGAGCAATGTATCTGTATTC

56

740

IMP R

TTAGTTGCTTGGTTTTGATG

 

 

blaVIM2

VIM F

TGGTCTACATGACCGCGTCT

56

766

VIM R

CGACTGAGCGATTTGTGTG

 

 

blaNDM-12

NDM-1 F

CAATATTATGCACCCGGTCG

56

726

NDM-1 R

ATCATGCTGGCCTTGGGGAA

 

 

mcr-13

CLR5-F

CGGTCAGTCCGTTTGTTC

56

309

CLR5-R

CTTGGTCGGTCTGTAGGG

 

 

mcr-1 / -24

mcr-12-281F

CTTATGGCACGGTCTATGA

54

650

mcr-12-930R

CACATTTTCTTGGTATTTGG

 

 

1. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 40sec) + 72℃ 7 min

2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 30sec) + 72℃ 7 min

3. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 56℃ 20sec + 72℃ 20sec) + 72℃ 7 min

4. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 54℃ 20sec + 72℃ 40sec) + 72℃ 7 min

나.
내성유전자 확인 참조균주

Target genes

참조균주

보유유전자

내성유전자

OXA-23

AB ROH0035G

OXA-23

IMP

PA ROH0020G

IMP-6

VIM

PA ROH0021G

VIM-2

GES

KP ROH0022G

GES-5

NDM

EC ROH0023G

NDM-1

NDM

EC ROH0034G

NDM-5

Campylobacter 균종
가.
내성유전자 확인 PCR

항목

Target gene

Primer

name

Primer sequence

Anealing T (℃)

Amplicon size (bp)

내성

유전자

qnrA1

For

GGCCATGGATATTATTGATAA

50

606

Rev

GGATCCGGGCAGCACTATTACTCC

 

qnrB12

For

CAGATTTCCGCGGCGCAAGC

60

353

Rev

CGCGATGCCAAGTCGCTCCA

 

qnrB42

For

TGACTCTGGCGTTAGTTGGCGA

60

609

Rev

GCAACGATGCCTGGTAGCTGTCC

 

qnrS2

For

TGCTGCGTCAGGAACGGCTG

60

466

Rev

TGAGCGTGGGTCTCGCGGTA

 

aac(6ʼ)Ib-cr3

For

ACGATTCCGTCACACTGCGCC

60

524

Rev

TCGCTCGAATGCCTGGCGTG

 

ermA4

For

ACGATATTCACGGTTTACCCACTTA

54

610

Rev

AACCAGAAAAACCCTAAAGACACG

 

ermB4

For

TAACGACGAAACTGGCTAAAAT

54

416

Rev

ATCTGTGGTATGGCGGGTAAG

 

1. PCR 조건: 95℃ 15 min + 40X (94℃ 1 min + 50℃ 2 min + 72℃ 3 min) + 72℃ 10 min

2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 40sec) + 72℃ 7 min

3. PCR 조건: 94℃ 5 min + 30X (94℃ 45sec + 55℃ 45sec + 72℃ 60sec) + 72℃ 10 min

4. PCR 조건: 95℃ 15 min + 40X (94℃ 20sec + 53℃ 20sec + 72℃ 40sec) + 72℃ 10 min