본문으로 바로가기 주메뉴 바로가기
최상단으로 이동

시험법

S. aureus, S. epidermidisS. pseudintermedius

가. 분석 원칙

  1. 1차 배지에서 Staphylococcus 균종이 의심되는 집락이 증식하면 MALDI-TOF 질량분석기로 동정을 시행한다.
  2. S. aureusS. epidermidis 균종으로 확인된 균주는 cefoxitin 디스크 확산법 결과에 따라 mecA PCR 및 SCCmec typing을 시행한다. Methicillin 내성인 균주가 mecA 음성인 경우는 mecC PCR을 시행한다. Methicillin 내성-mecA 음성-mecC 음성인 경우는 주관부서에 통보한다.
  3. MALDI-TOF 질량 분석기에서 S. intermedius S. pseudintermedius로 확인된 균주는 nuc gene PCR을 시행하여 최종 동정을 시행한다. S. pseudintermedius로 확인된 균주는 oxacillin 디스크 확산법의 결과에 따라 mecA PCR 및 SCCmec typing을 시행한다. Methicillin 내성인 균주가 mecA 음성인 경우는 mecC PCR을 시행한다. Methicillin 내성-mecA 음성-mecC 음성인 경우는 주관부서에 통보한다.
  4. Staphylococcus 균종은 SCCmec type의 비교를 위해 S. aureus의 SCCmec typing 방법을 사용하는 것을 원칙으로 한다, 하지만 S. epidermidis S. pseudintermedius 에 해당하는 균주의 SCCmec typing이 불가능한 경우는 whole genome sequencing을 통하여 SCCmec type을 확인한다.

나. 내성유전자 확인 PCR

S. aureus, S. epidermidis 및 S. pseudintermedius 내성유전자 확인 PCR 정보 표
특성 Genes Primer Sequence Anealing T (℃) Amplicon
내성 유전자 mecA1 mA1 TGCTATCCACCCTCAAACAGG 59 286
mA2 AACGTTGTAACCACCCCAAGA
mecC2 mecC MFP GAAAAAAAGGCTTAGAACGCCTC 60 138
mecC MRP GAAGATCTTTTCCGTTTTCAGC
분자역학 SCCmec3 ccrA1 CAAGCCTTATCAGGTACGAA 56 5: 202 bp
2: 307 bp
4: 406 bp
7: 519 bp
1: 672 bp
8: 802 bp
3: 982 bp
ccrA2 CATTACGTCAACAACCGCAA
ccrA3 CTGAATCATTCAGAAAACAGAC
ccrA4 GTCCTAAAACAGCAACAAATGA
ccrB1 GAGCATTAACTTGCCTGTTG
ccrB2 CCTTCTGTGCTTTGCATTTC
ccrB3 GACCTTCGTTCGCATCTTTT
ccrB4 GGTTACAGTATTCAAGGTCAAT
ccrB6 CTGGTATGTTATTATATCCTAAAG
ccrC1 GCAATGAAACGTCTATTACAAG
ccrC2 CAAACATTGTAACGAGTACTTC
mecA_univ CTGCTATCTTTATAAACTTGTTTG 56 A: 1358 bp
B: 1235 bp
C1: 717 bp
C2: 533 bp
E: 979 bp
mecA_E ACATAACCTAAAAGGTGTACTG
mecR1_B TCATGTGAAGCTCGATATACTA
ecR1_E ACCAAACTTTATGATTTAACTGAG
merR1_A TTCATTATAAAGCACAAAACTTCC
IS431_C2 GTTGAATGATGAACGTTTACAC
IS431_C1 GGGACATACATTAGATATTTGG
1. PCR 조건: 94℃ 2 min + 30X (94℃ 2 min + 57℃ 1 min + 72℃ 2 min) + 72℃ 2 min
2. PCR 조건: 94℃ 15 min + 30X (94℃ 30sec + 59℃ 1 min + 72℃ 1 min) + 72℃ 10 min
3. ccr gene PCR 조건: 95℃ 5 min + 28X (97℃ 10sec + 56℃ 20sec + 72℃ 40 sec) + 72℃ 7 min
4. mec gene PCR 조건: 95℃ 5 min + 28X (97℃ 10sec + 56℃ 20sec + 72℃ 1 min) + 72℃ 7 min
내성유전자 확인 PCR 이미지
| Figure Ⅴ-1 | Staphylococcus 균종의 분석 흐름도

다. SCCmec typing 해석

  1. SCCmec type은 ccr 유전자의 종류와 mec gene complex의 조합에 따라 SCCmec type이 결정된다.
  2. ccr multiplex PCR 결과에 따라 ccr 유전자의 종류를 결정한다.
  3. mec gene complex muliplex PCR 결과에 따라 mec gene complex 종류를 결정한다.
  4. ccr 유전형과 mec gene 유전형을 조합하여 SCCmec 유전형을 결정한다.
S. aureus, S. epidermidis 및 S. pseudintermedius SCCmec typing 해석 정보 표
SCCmec type ccr (bp) mec gene complex (bp)
I 672 1235
II 307 1358
III 982 1358
IV 307 1235
V 202 533
VI 406 1235
VII 202 717
VIII 406 1358
IX 672 533
X 517 717
XI 802 979

라. 유전자 분석 참조균주

S. aureus, S. epidermidis 및 S. pseudintermedius 유전자 분석 참조균주
Target genes 참조균주
내성유전자 mecA SA ROH0001G
SCCmec SCCmec I ATCC BAA-44
SCCmec II SA ROH0028G
SCCmec III ATCC 33592
SCCmec IV SA ROH0029G
SCCmec V ATCC BAA-2094
SCCmec VII SA ROH0030G
SCCmec XI (mecC) ATCC BAA-2313
Typing agr I SA ROH0004G
agr II SA ROH0005G
agr III SA ROH0006G
agrIV SA ROH0007G
E. faecalisE. faecium

가. 내성유전자 확인 PCR (Vancomycin 디스크 억제대 ≤ 16 mm)

E. faecalis 및 E. faecium 의 내성유전자 확인 PCR(Vancomycin 디스크 억제대 ≤ 16 mm 인 항목별 정보 표)
항목 유전자 Primer Sequence Anealing T (℃) Amplicon
내성 유전자 vanA1 vanA F AGCTGTACTCTCGCCGGATA 52 320
vanAR CCGGCTTAACAAAAACAGGA
vanB1 vanB F GGCTCAGAAAATGCGATGAT 52 250
vanB R TGTCAATCAGTGCAGGAAGC
vanM2 vanHM F CAGCGTGGGGCACAAGTCTGA 58 377
vanHM R TGCCGTACGCCAACACGTGA
1. PCR 조건: 94℃ 3 min + 30X (94℃ 1 min + 52℃ 30sec + 72℃ 30sec) + 72℃ 10 min
2. PCR 조건: 94℃ 3 min + 30X (94℃ 1 min + 55℃ 30sec + 72℃ 30sec) + 72℃ 10 min

나. 유전자 분석 참조균주

E. faecalis 및 E. faecium의 유전자 분석 참조균주 정보 표
Target genes 참조균주
내성유전자 vanA EM ROH0015G
vanB ATCC 51575
E. coli, K. pneumoniae, Citrobacter 균종, Enterobacterer 균종,
Salmonella 균종 및 Shigella 균종

가. 특성 분석 원칙

  1. E. coliK. pneumoniae
    • 가) 1차 배지에서 의심 집락이 증식하면 MALDI-TOF 질량분석기로 동정을 시행한다.
    • 나) E. coliK. pneumoniae로 확인된 균주는 항생제 감수성 결과에 따라 ESBL 생성 의심 균주, PABL (Plasmid-mediated AmpC β-lactamase) 생성 의심 균주 및 CPE 의심 균주로 분류한다.
    • 다) 의심되는 내성의 양상에 따라 ESBL double disk synergy 검사 및 CarbaNP 또는 mCIM 추가 감수성 시험을 시행하고, 내성 유전자 PCR 및 염기서열분석을 시행한다(시험 균주에 따라 추가 감수성 시험은 생략할 수 있다).
    • 라) BMD로 시행한 colistin 감수성 시험에서 MIC ≥ 4 μg/mL이면 mcr(mobile colistin resistance)에 대한 PCR을 시행한다.
  2. Citrobacter 균종 및 Enterobacter 균종
    • 가) 1차 배지에서 의심 집락이 증식하면 MALDI-TOF 질량분석기로 동정을 시행한다.
    • 나) Citrobacter 균종 및 Enterobacter 균종으로 확인된 균주는 항생제 감수성 결과에 따라 ESBL 생성 의심 균주 및 CPE 의심 균주로 분류한다. Citrobacter 균종과 Enterobacter 균종은 유전자에 ampC β-lactamase를 가지고 있으므로 PABL은 시험하지 않는다.
    • 다) 의심되는 내성의 양상에 따라 ESBL double disk synergy 검사 및 carbaNP 또는 mCIM 추가 감수성 시험을 시행하고, 내성 유전자 PCR 및 염기서열분석을 시행한다(시험 균주에 따라 추가 감수성 시험은 생략할 수 있다).
    • 라) BMD로 시행한 colistin 감수성 시험에서 MIC ≥ 4 μg/mL이면 mcr (mobile colistin resistance)에 대한 PCR을 시행한다.
  3. Salmonella 균종 및 Shigella 균종
    • 가) 1차 배지에서 의심 집락이 증식하면 항혈청, MALDI-TOF 질량분석기 또는 자동화 장비로 동정을 시행한다.
    • 나) Salmonella 균종 및 Shigella 균종으로 확인된 균주는 항생제 감수성 결과에 따라 ESBL 생성 의심 균주로 분류하고 추가 감수성 시험 (Double disk synergy), ESBL PCR 및 염기서열 분석을 시행한다.
    • 다) Salmonella 균종에서 quinolone 내성이 의심되는 경우는 QRDR (quinolone-resistance determining region)에 대한 염기서열분석을 시행한다.
    • 라) BMD로 시행한 colistin 감수성 시험에서 MIC ≥ 4 μg/mL이면 mcr (mobile colistin resistance)에 대한 PCR을 시행한다.

나. 내성유전자 확인 PCR

. coli, K. pneumoniae, Citrobacter 균종, Enterobacterer 균종,Salmonella 균종 및 Shigella 균종의 내성유전자 확인 PCR 정보 표
항목 Target gene Primer name Primer sequence Anealing T (℃) Amplicon size (bp)
내성 유전자 blaOXA-231 OXA-23 F CTCTTTTTCTTTCTGGTTGTAC 54 776
OXA-23 R CAGCTGTTTTAATGATTTCATC
blaOXA-241 OXA-24 F CTTCCTATATTCAGCATTTCTATT 56 807
OXA-24 R GATTCCAAGATTTTCTAGCGAC
blaOXA-581 OXA-58 F GCTTAAGCATAAGTATTGGGG 55 793
OXA-58 R CCCAACTTATCTAGCACATC
blaOXA-481 OXA-48 F TTGGTGGCATCGATTATCGG 57 744
OXA-48 R GAGCACTTCTTTTGTGATGGC
blaOXA-1432 OXA-143 F CTTCCTATTCTCAGCATTTCTAC 56 820
OXA-143 R CCCTAAATTATATAATCCCTAAATTC
blaOXA-2352 OXA-235 F GAAAACTCTTATTTTGTTGCCTTTA 56 826
OXA-235 R CCCTTCAGCTTTCGGATAAAG
blaOXA-511 OXA-51 F GAACATTAAAACACTCTTACTTAT 56 823
OXA-51 R TTAGAACAATTAGGTATTTTATAG
ISAba1-blaOXA-512 ISAba1-OXA-51 F CCCATTTCCAATTGGTTCTATC 56 570
ISAba1-OXA-51 R CCATAGCTTTGTTGAGTTTGG
blaTEM3 TEM F ATGAGTATTCAACATTTCCGT 59 861
TEM R TTACCAATGCTTAATCAGTGA
blaSHV3 SHV F CCGGGTTATTCTTATTTGTCGCT 61 927
SHV R TAGCGTTGCCAGTGCTCG
blaCTX-M-11 CTXM-1 F ACCGTCACGCTGTTGTTAGG 56 819
CTXM-1 R GTCGGTGACGATTTTAGCCG
blaCTX-M-21 CTXM-2 F AATGTTAACGGTGATGGCGA 56 844
CTXM-2 R ACCGTGGGTTACGATTTTCG
blaCTX-M-91 CTXM-9 F GTGCAACGGATGATGTTCG 56 845
CTXM-9 R ATGATTCTCGCCGCTGAAG
blaCTX-M-251 CTXM-25 F GTAAGGCGGGCGATGTTAAT 56 856
CTXM-25 R AACCGTCGGTGACAATTCTG
blaKPC2 KPC F ATGTCACTGTATCGCCGTCT 56 893
KPC R TTTTCAGAGCCTTACTGCCC
blaPER4 PER F GAATGTCATTATAAAAGCTGTAGT 55 915
PER R CTTAGGGCAGAAAGCTTTTTC
blaGES2 GES F GCGCTTCATTCACGCACTAT 56 753
GES R GCGTAATCTCTCTCCTGGGC
blaIMP2 IMP F TGAGCAATGTATCTGTATTC 56 740
IMP R TTAGTTGCTTGGTTTTGATG
blaVIM2 VIM F TGGTCTACATGACCGCGTCT 56 766
VIM R CGACTGAGCGATTTGTGTG
blaNDM-12 NDM-1 F CAATATTATGCACCCGGTCG 56 726
NDM-1 R ATCATGCTGGCCTTGGGGAA
blaCMY-15 MOXM F CAACAACGACAATCCATCCTG 58 1086
MOXM R GTTGCGATTGGCCAGCATG
blaCMY-25 CIT F TGATGAAAAAATCGTTATGCTCC 56 1097
CIT R GTTAGGATAGCTTTTGTTTGCC
blaDHA6 DHA F GTTATCTGCAACACTGATTTCC 56 1118
DHA R CACTCAAAATAGCCTGTGCAG
blaACC6 ACC F GAACACATTGAAGCTGTTATCC 56 1153
ACC R CTTATTCCCTTCCAATGAGCTC
blaACT-16 ACT F GATGACAAAATCCCTAAGCTGT 56 1098
ACT R GGGTTCGGATAGCTTTTATTC
blaFOX6 FOX F CATTATCCAGCCGATGCTCAA 58 1001
FOX R TGGCCTCGATGGGATAGTTG
mcr-17 CLR5-F CGGTCAGTCCGTTTGTTC 56 309
CLR5-R CTTGGTCGGTCTGTAGGG
mcr-1 / -28 mcr-12-281F CTTATGGCACGGTCTATGA 54 650
mcr-12-930R CACATTTTCTTGGTATTTGG
1. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 40sec) + 72℃ 7 min
2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 30sec) + 72℃ 7 min
3. PCR 조건: 94℃ 5 min + 35X (94℃ 30sec + Anealing T(℃) 30sec + 72℃ 30sec) + 72℃ 7 min
4. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 1 min) + 72℃ 7 min
5. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + Anealing T(℃) 30sec + 72℃ 1 min) + 72℃ 7 min
6. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 1 min) + 72℃ 7 min
7. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 56℃ 20sec + 72℃ 20sec) + 72℃ 7 min
8. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 54℃ 20sec + 72℃ 40sec) + 72℃ 7 min
E. coli, K. pneumoniae, Citrobacter 균종 및 Enterobact er 균종의 분석 흐름도 이미지
| Figure Ⅴ-2 | E. coli, K. pneumoniae, Citrobacter 균종 및 Enterobacter 균종의 분석 흐름도
Salmonella 균종 및 Shigella 균종의 분석 흐름도 이미지
| Figure Ⅴ-3 | Salmonella 균종 및 Shigella 균종의 분석 흐름도

다. 내성유전자 확인 참조균주

E. coli, K. pneumoniae, Citrobacter 균종, Enterobacterer 균종,Salmonella 균종 및 Shigella 균종 별 내성유전자 확인 참조균주 표
Target genes 참조균주 보유유전자
내성유전자 CTX-M1 EC ROH0016G CTX-M15
CTX-M1 EC ROH0031G CTX-M55
CTX-M1 EC ROH0032G CTX-M186
CTX-M9 EC ROH0017G CTX-M14
CTX-M9 EC ROH0033G CTX-M27
TEM EC ROH0018G TEM-1
SHV KP ROH0019G SHV-1
IMP PA ROH0020G IMP-6
VIM PA ROH0021G VIM-2
GES KP ROH0022G GES-5
NDM EC ROH0023G NDM-1
NDM EC ROH0034G NDM-5
KPC KP ROH0024G KPC-2
OXA-48 KP ROH0025G OXA-232
DHA-1 EC ROH0026G DHA-1
CMY-2 EC ROH0027G CMY-2

라. 내성 기전 표현형 시험

  1. Double disk synergy 시험
    • 하룻밤 배양한 시험 대상 균주를 사용하여 0.5 McF 균액을 만들고, 디스크 확산법 검사와 같은 방법으로 MHA에 접종한다.
    • 배지의 정중앙에 clavulanic acid 또는 clavulanic acid가 포함된 항생제 디스크를 놓는다.
    • Clavulanic acid 디스크를 중심으로 클로버 모양으로 cetotaxime, ceftazidime 또는 cefepime 디스크를 디스크 가장 자리가 1.5-2 cm 간격이 되도록 놓는다.
    • 35℃±2℃에서 18-24시간 동안 배양한다.
    • Clavulanic acid와 cefotaxime, ceftazidime 또는 cefepime 디스크 간에 억제대의 증폭이 있으면 양성으로 판정한다.
      Cefepime과 amoxicillin-clavulanic acid 디스크를 사용한 double disk synergy 시험 결과 이미지
      | Figure Ⅴ-4 | Cefepime과 amoxicillin-clavulanic acid 디스크를 사용한 double disk synergy 시험 결과
      파란색 원은 억제대의 변화가 없음을 나타내고 붉은 색 원은 억제대의 증폭이 발생하여 ESBL 양성임을 나타낸다.
  2. Carba NP 시험 (Rapiddec Carba NP, bioMerieux, Marcy Eʼtolile, France)
    • 2개의 microcentrifuge tube에 라벨을 표기한다(a 및 b).
    • 각 tube에 100 μL의 bacterial protein extraction 용액을 각각 넣는다.
    • 하룻밤 배양한 시험 대상 균주를 1 μL 루프 (1/1000 백금이)를 사용하여 각각의 tube에 접종하고 5초간 vortex로 혼합한다.
    • 시험 용액 A와 B를 각각의 라벨이 붙은 tube에 접종한다(상용 시약).
    • vortex를 사용하여 tube를 잘 혼합한다.
    • 35℃±2℃에서 2시간 동안 배양한다.
    • 판독한다 (시약 매뉴얼 참조)
  3. Modified carbapenem inactivation method (mCIM)
    • 하룻밤 배양한 시험 대상 균주를 1 μL 루프 (1/1000 백금이)를 사용하여 2 mL TSB에 접종한다.
    • 10-15초간 vortex를 사용하여 혼합한다.
    • 10 μg meroepenem 디스크를 멸균된 기구 (forcep)를 사용하여 균액 (세균이 접종된 2 mL TSB)에 완전히 잠기도록 넣는다.
    • 35℃±2℃에서 4시간±15분 동안 배양한다.
    • E. coli ATCC 25922 표준 균주를 사용하여 0.5 McF 탁도의 균액을 준비한다.
    • 준비된 E. coli ATCC 25922 균액은 15분 이내에 MHA 한천 배지에 접종하고 3-10분간 배지를 건조시킨다.
    • 다)에서 사용한 TSB에서 meropenem 디스크를 무균법으로 꺼내어 바)에서 준비한 배지에 디스크 확산법 검사하는 것처럼 접종한다.
    • 35℃±2℃에서 18-24시간 배양한다.
    • 15 mm 이하의 억제대가 생기거나 16-18 mm 영역에 집락이 형성되면 carbapenemase 양성으로 판정한다.
P. aeruginosa

가. 내성기전 분석 PCR

Carbapenem에 대해서 중간이거나 내성인 균주 및 BMD로 시행한 감수성 시험에서 MIC ≥ 4 μg/mL

P. aeruginosa 내성기전 분석 PCR
항목 Target gene Primer name Primer sequence Anealing T (℃) Amplicon size (bp)
내성 유전자 bla PER1 PER F GAATGTCATTATAAAAGCTGTAGT 55 915
PER R CTTAGGGCAGAAAGCTTTTTC
bla GES2 GES F GCGCTTCATTCACGCACTAT 56 753
GES R GCGTAATCTCTCTCCTGGGC
bla IMP2 IMP F TGAGCAATGTATCTGTATTC 56 740
IMP R TTAGTTGCTTGGTTTTGATG
bla VIM2 VIM F TGGTCTACATGACCGCGTCT 56 766
VIM R CGACTGAGCGATTTGTGTG
bla NDM-12 NDM-1 F CAATATTATGCACCCGGTCG 56 726
NDM-1 R ATCATGCTGGCCTTGGGGAA
mcr -13 CLR5-F CGGTCAGTCCGTTTGTTC 56 309
CLR5-R CTTGGTCGGTCTGTAGGG
mcr -1 / -24 mcr-12-281F CTTATGGCACGGTCTATGA 54 650
mcr-12-930R CACATTTTCTTGGTATTTGG
1. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + 55℃ 20sec + 72℃ 1 min) + 72℃ 7 min
2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 30sec) + 72℃ 7 min
3. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 56℃ 20sec + 72℃ 20sec) + 72℃ 7 min
4. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 54℃ 20sec + 72℃ 40sec) + 72℃ 7 min

나. 내성유전자 확인 참조균주

P. aeruginosa 내성유전자 확인 참조균주 정보표
Target genes 참조균주 보유유전자
내성유전자 IMP PA ROH0020G IMP-6
VIM PA ROH0021G VIM-2
GES KP ROH0022G GES-5
NDM EC ROH0023G NDM-1
NDM EC ROH0034G NDM-5
A. baumannii, A. nosocomialisA. pittii

가. 내성유전자 확인 PCR

Carbapenem에 대해서 중간이거나 내성인 균주 및 BMD로 시행한 감수성 시험에서 MIC ≥ 4 μg/mL일 때 시행

A. baumannii, A. nosocomialisA. pittii 내성유전자 확인 PCR 정보 표
항목 Target gene Primer name Primer sequence Anealing T (℃) Amplicon size (bp)
내성 유전자 blaOXA-231 OXA-23 F CTCTTTTTCTTTCTGGTTGTAC 54 776
OXA-23 R CAGCTGTTTTAATGATTTCATC
blaOXA-241 OXA-24 F CTTCCTATATTCAGCATTTCTATT 56 807
OXA-24 R GATTCCAAGATTTTCTAGCGAC
blaOXA-581 OXA-58 F GCTTAAGCATAAGTATTGGGG 55 793
OXA-58 R CCCAACTTATCTAGCACATC
blaOXA-481 OXA-48 F TTGGTGGCATCGATTATCGG 57 744
OXA-48 R GAGCACTTCTTTTGTGATGGC
blaOXA-511 OXA-51 F GAACATTAAAACACTCTTACTTAT 56 823
OXA-51 R TTAGAACAATTAGGTATTTTATAG
ISAba1-blaOXA-512 ISAba1-OXA-51 F CCCATTTCCAATTGGTTCTATC 56 570
ISAba1-OXA-51 R CCATAGCTTTGTTGAGTTTGG
blaIMP2 IMP F TGAGCAATGTATCTGTATTC 56 740
IMP R TTAGTTGCTTGGTTTTGATG
blaVIM2 VIM F TGGTCTACATGACCGCGTCT 56 766
VIM R CGACTGAGCGATTTGTGTG
blaNDM-12 NDM-1 F CAATATTATGCACCCGGTCG 56 726
NDM-1 R ATCATGCTGGCCTTGGGGAA
mcr-13 CLR5-F CGGTCAGTCCGTTTGTTC 56 309
CLR5-R CTTGGTCGGTCTGTAGGG
mcr-1 / -24 mcr-12-281F CTTATGGCACGGTCTATGA 54 650
mcr-12-930R CACATTTTCTTGGTATTTGG
1. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 40sec) + 72℃ 7 min
2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 30sec) + 72℃ 7 min
3. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 56℃ 20sec + 72℃ 20sec) + 72℃ 7 min
4. PCR 조건: 94℃ 5 min + 25X (94℃ 30sec + 54℃ 20sec + 72℃ 40sec) + 72℃ 7 min

나. 내성유전자 확인 참조균주

A. baumannii, A. nosocomialisA. pittii 의 내성유전자 확인 참조균주 정보표
Target genes 참조균주 보유유전자
내성유전자 OXA-23 AB ROH0035G OXA-23
IMP PA ROH0020G IMP-6

VIM
PA ROH0021G VIM-2

GES
KP ROH0022G GES-5

NDM
EC ROH0023G NDM-1
NDM EC ROH0034G NDM-5
Campylobacter 균종

가. 내성유전자 확인 PCR

Carbapenem에 대해서 중간이거나 내성인 균주 및 BMD로 시행한 감수성 시험에서 MIC ≥ 4 μg/mL일 때 시행

Carbapenem 균종에 대한 내성유전자 확인 PCR 항목별 Target gene, Primer name 등의 정보 표
항목 Target gene Primer name Primer sequence Anealing T (℃) Amplicon size (bp)
내성
유전자
qnrA1 For GGCCATGGATATTATTGATAA 50 606
Rev GGATCCGGGCAGCACTATTACTCC
qnrB12 For CAGATTTCCGCGGCGCAAGC 60 353
Rev CGCGATGCCAAGTCGCTCCA
qnrB42 For TGACTCTGGCGTTAGTTGGCGA 60 609
Rev GCAACGATGCCTGGTAGCTGTCC
qnrS2 For TGCTGCGTCAGGAACGGCTG 60 466
Rev TGAGCGTGGGTCTCGCGGTA
aac(6ʼ)Ib-cr3 For ACGATTCCGTCACACTGCGCC 60 524
Rev TCGCTCGAATGCCTGGCGTG
ermA4 For ACGATATTCACGGTTTACCCACTTA 54 610
Rev AACCAGAAAAACCCTAAAGACACG
ermB4 For TAACGACGAAACTGGCTAAAAT 54 416
Rev ATCTGTGGTATGGCGGGTAAG
1. PCR 조건: 95℃ 15 min + 40X (94℃ 1 min + 50℃ 2 min + 72℃ 3 min) + 72℃ 10 min
2. PCR 조건: 94℃ 5 min + 30X (94℃ 30sec + Anealing T(℃) 20sec + 72℃ 40sec) + 72℃ 7 min
3. PCR 조건: 94℃ 5 min + 30X (94℃ 45sec + 55℃ 45sec + 72℃ 60sec) + 72℃ 10 min
4. PCR 조건: 95℃ 15 min + 40X (94℃ 20sec + 53℃ 20sec + 72℃ 40sec) + 72℃ 10 min